Last updated on 2025-07-06 05:50:23 CEST.
Flavor | Version | Tinstall | Tcheck | Ttotal | Status | Flags |
---|---|---|---|---|---|---|
r-devel-linux-x86_64-debian-clang | 1.2.0 | 13.40 | 107.25 | 120.65 | OK | |
r-devel-linux-x86_64-debian-gcc | 1.2.0 | 8.72 | 78.37 | 87.09 | OK | |
r-devel-linux-x86_64-fedora-clang | 1.2.0 | 194.00 | OK | |||
r-devel-linux-x86_64-fedora-gcc | 1.2.0 | 179.27 | OK | |||
r-devel-windows-x86_64 | 1.2.0 | 15.00 | 100.00 | 115.00 | OK | |
r-patched-linux-x86_64 | 1.2.0 | 12.05 | 103.52 | 115.57 | OK | |
r-release-linux-x86_64 | 1.2.0 | 11.96 | 101.35 | 113.31 | OK | |
r-release-macos-arm64 | 1.2.0 | 50.00 | OK | |||
r-release-macos-x86_64 | 1.2.0 | 92.00 | OK | |||
r-release-windows-x86_64 | 1.2.0 | 15.00 | 0.00 | 15.00 | FAIL | |
r-oldrel-macos-arm64 | 1.2.0 | 50.00 | NOTE | |||
r-oldrel-macos-x86_64 | 1.2.0 | 81.00 | NOTE | |||
r-oldrel-windows-x86_64 | 1.2.0 | 18.00 | 129.00 | 147.00 | NOTE |
Version: 1.2.0
Check: PDF version of manual
Result: FAIL
Check process probably crashed or hung up for 20 minutes ... killed
Most likely this happened in the example checks (?),
if not, ignore the following last lines of example output:
>
> flush(stderr()); flush(stdout())
>
> ### Name: GetNewSpacer
> ### Title: Get the new spacer from the molecular sequence.
> ### Aliases: GetNewSpacer
>
> ### ** Examples
>
> GetNewSpacer("AGAGGCGGACCGAAAAACCGTTTTCAGCCAACGTAT")
NULL
>
>
>
>
> ### * <FOOTER>
> ###
> cleanEx()
> options(digits = 7L)
> base::cat("Time elapsed: ", proc.time() - base::get("ptime", pos = 'CheckExEnv'),"\n")
Time elapsed: 3.31 0.28 3.6 NA NA
> grDevices::dev.off()
null device
1
> ###
> ### Local variables: ***
> ### mode: outline-minor ***
> ### outline-regexp: "\\(> \\)?### [*]+" ***
> ### End: ***
> quit('no')
======== End of example output (where/before crash/hang up occured ?) ========
Flavor: r-release-windows-x86_64
Version: 1.2.0
Check: LazyData
Result: NOTE
'LazyData' is specified without a 'data' directory
Flavors: r-oldrel-macos-arm64, r-oldrel-macos-x86_64, r-oldrel-windows-x86_64